90
|
Tocris
pkra7 antagonist  Pkra7 Antagonist, supplied by Tocris, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pkra7 antagonist/product/Tocris Average 90 stars, based on 1 article reviews
pkra7 antagonist - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
91
|
Cell Signaling Technology Inc
solids concentration Solids Concentration, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/solids concentration/product/Cell Signaling Technology Inc Average 91 stars, based on 1 article reviews
solids concentration - by Bioz Stars,
2026-04
91/100 stars
|
Buy from Supplier |
86
|
Mikromol
95 3 mean sd conclusion 95 3 Mean Sd Conclusion, supplied by Mikromol, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/95 3 mean sd conclusion/product/Mikromol Average 86 stars, based on 1 article reviews
95 3 mean sd conclusion - by Bioz Stars,
2026-04
86/100 stars
|
Buy from Supplier |
90
|
Henkel Corporation
macromelt® 6238 Macromelt® 6238, supplied by Henkel Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/macromelt® 6238/product/Henkel Corporation Average 90 stars, based on 1 article reviews
macromelt® 6238 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Utah Medical
transducer #6238 Transducer #6238, supplied by Utah Medical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/transducer #6238/product/Utah Medical Average 90 stars, based on 1 article reviews
transducer #6238 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Trouw Nutrition USA LLC
mn (mno) 6238 mg Mn (Mno) 6238 Mg, supplied by Trouw Nutrition USA LLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mn (mno) 6238 mg/product/Trouw Nutrition USA LLC Average 90 stars, based on 1 article reviews
mn (mno) 6238 mg - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Chemdiv Inc
compound 3-[1-[(aminocarbonyl)amino]-5-(4-methoxyphenyl)-1h-pyrrol-2-yl] propanoic acid chemdiv_id: 6238-0047 Compound 3 [1 [(Aminocarbonyl)Amino] 5 (4 Methoxyphenyl) 1h Pyrrol 2 Yl] Propanoic Acid Chemdiv Id: 6238 0047, supplied by Chemdiv Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/compound 3-[1-[(aminocarbonyl)amino]-5-(4-methoxyphenyl)-1h-pyrrol-2-yl] propanoic acid chemdiv_id: 6238-0047/product/Chemdiv Inc Average 90 stars, based on 1 article reviews
compound 3-[1-[(aminocarbonyl)amino]-5-(4-methoxyphenyl)-1h-pyrrol-2-yl] propanoic acid chemdiv_id: 6238-0047 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
The Coleman Company Inc
ice chest 40 qt wheeled cooler 6238-6341 Ice Chest 40 Qt Wheeled Cooler 6238 6341, supplied by The Coleman Company Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ice chest 40 qt wheeled cooler 6238-6341/product/The Coleman Company Inc Average 90 stars, based on 1 article reviews
ice chest 40 qt wheeled cooler 6238-6341 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Verlag GmbH
tem image of cuii cp 6238 Tem Image Of Cuii Cp 6238, supplied by Verlag GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tem image of cuii cp 6238/product/Verlag GmbH Average 90 stars, based on 1 article reviews
tem image of cuii cp 6238 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
ERBA Diagnostics
dbr erba wilhelmstrasse 2 b 6238 hofheirn/taunus Dbr Erba Wilhelmstrasse 2 B 6238 Hofheirn/Taunus, supplied by ERBA Diagnostics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dbr erba wilhelmstrasse 2 b 6238 hofheirn/taunus/product/ERBA Diagnostics Average 90 stars, based on 1 article reviews
dbr erba wilhelmstrasse 2 b 6238 hofheirn/taunus - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
N/A
|
Hairpin precursor miRNA of approximately 150 nucleotides is cloned into lentiviral or non-viral vectors for delivery in virtually all cell types.
|
Buy from Supplier |
N/A
|
strong MicroRNA mmu miR 6238 strong Accession Number MIMAT0024859 Mature Sequence UUAUUAGUCAGUGGAGGAAAUG mmu miR 6238 are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor structures miRNAs
|
Buy from Supplier |
Image Search Results
Journal: The EMBO Journal
Article Title: Single‐cell transcriptomics of suprachiasmatic nuclei reveal a Prokineticin‐driven circadian network
doi: 10.15252/embj.2021108614
Figure Lengend Snippet:
Article Snippet: Recombinant Prok2 was purchased from Sigma Aldrich (#SRP3146) and
Techniques: Plasmid Preparation, Recombinant, Modification, RNAscope, Multiplex Assay, Software